Quixoticals Is No Longer Being Updated

Quixoticals is no longer being updated. If you like quixoticals, check out my new blog Staretube -- a gallery of unusual videos.

Friday, March 23, 2007

A Tattoo for the Educated Man


I have profiled tattoos here before, mostly examples of a dubious nature. However, this tattoo is one of my favourites. The straightforward reason for loving this tattoo is that it's just damn cool. It speaks to me as someone who has often wanted a tattoo but doesn't want to scar up his body with something he might regret.

There are many ways to approach this tattoo. One can say it is a post-modern interpretation of physicality. It could speak about thoughts in relation to flesh. Or perhaps it's just there for mere decoration.

In any sense, this is one of the few tattoos that have truly made me think. Tattoos are not just the domain for bikers and brutes. They are for the thinking man as well.

30 comments:

Miss Cellania said...

What is the text inside? I can't see it very well. Is it from a recognizable source?

Anonymous said...

..that's because you should click the picture to get a larger version ;)

It seems to be a collection of, say, tags: of stuff he likes or feels they define him - not all readable, and that adds to the coolness, I guess :)

Huffer

Dan Earles said...

We at least it is personal - I always thought getting other peoples words on you was a bit odd - but each to his own.

Anonymous said...

That tattoo says one thing to me: I'm a weenie.

bnoble said...

For the "educated man"? Why? Because it contains the words hyperarticulate and bacon? Sorry, reeks of smugness and a little self-importance to me, not smarts.

Frank said...

I think it would be cool to have some DNA code


AGTAAGCTAAGGCAATCCGATTATTACC ... etc

Gregory Perry said...

"One can say it is a post-modern interpretation of physicality. It could speak about thoughts in relation to flesh. Or perhaps it's just there for mere decoration."

This blog post made me puke on my shoes.

Anonymous said...

Couldn't agree more, gregory.

My impression is that underneath his paperthin skin is a bunch of meaningless bullshit. Sad, not cool.

Anonymous said...

wow.. cant believe all the self-indulgent tattoo experts here... sad, weeny, stupid tatoo? and puking while reading the blog? what a pathetic batch of goons you people are. The tattoo looks cool and helluva lot differnet than the crap other poeple call a "tattoo"... 'waste of ink' is what I call most of what is out there.... too bad you're all offended with your thin skin and

frederika said...

You forgot one word: depilation.

John said...

i was hoping it would be DNA code as well frank. now that would be cool.

Anonymous said...

nice man tits

Stuart Dent said...

Frank, I just thought you might like to know that the sequence of DNA that you typed in was from a Zebrafish.

http://www.ncbi.nlm.nih.gov/BLAST/Blast.cgi

Anonymous said...

I would have gone with 1s and 0s myself

Anonymous said...

So much hate, what's up with that.

This particular tat is not my thing. It's too big imo, but I do appreciate the art and the thought that was put into it.

heathen said...

"Tattoos are not just the domain for bikers and brutes. They are for the thinking man as well"

hmmmm don't go to a tattoo convention saying twatish things like this will you.

Anonymous said...

So much hate, what's up with that.

This particular tat is not my thing. It's too big imo, but I do appreciate the art and the thought that was put into it.


What's up with that? Well I think it might have something to do with that shitsucking expression on his face. Would have helped a bit if that had been excluded, IMHO.

Anonymous said...

Mama always said, "You can suck in your gut, but you ain't never could fer suckin' in yer titties, boy."

Damn you, mama. Damn you and how right you were. :(

Anonymous said...

Tattoos are personal and shouldn't be up for debate amongst anyone. At least that's how I feel about mine. If you're tats don't mean anything to you than perhaps you are a waste of flesh. Anyway, looks like some nice work; who did it?

Rajindar said...

Wow. Never have I seen a better use of someone's "general interest" list from myspace.

Anonymous said...

You ppl r all just mean and meanies ur the weenies lol

Anonymous said...

I'm surprised by all the negativity. I was thinking it's one of the coolest tattoos I've seen.

Anonymous said...

In any sense, this is one of the few tattoos that have truly made me think. Tattoos are not just the domain for bikers and brutes. They are for the thinking man as well.


So.. you just haven't seen very many tattoos, is my understanding. Or perhaps you prefer to think in stereotypes.

Anonymous said...

Yes, it really DOES make you think If you've NEVER THOUGHT BEFORE.

Anonymous said...

more like "A Tattoo for a lazy pretentious snobbish A-hole"

not much thinking involved as far as I can see..

Anonymous said...

very dumb tattoo and even dumber musings on it. there is nothing educated about this titty man's ugly carved up arm.

Anonymous said...

not too sure about the words used but thats why its not my tattoo. Awesome artwork and workmanship. I think it looks awesome!

Anonymous said...

The whole ideea of a tatto is to MARK something in ones life. it doesn't have to be pretty , smart or else.
it just has to have a MEANING for that person.That's the end of story.

Anonymous said...

...banana

kriselis said...

well, i like it. a whole lot actually... it's different. it isn't some stupid chinese character for 'original' that nearly every other 16 year old chick has tattooed on her crack. and it certainly isn't some stupid "remember to breathe or you'll die as an aerobic creature" on your inner wrist.

i like it. it's original & really, it makes no difference whether i like it nor not either. its yours and yours alone.

good work.