
I have profiled tattoos here before, mostly examples of a dubious nature. However, this tattoo is one of my favourites. The straightforward reason for loving this tattoo is that it's just damn cool. It speaks to me as someone who has often wanted a tattoo but doesn't want to scar up his body with something he might regret.
There are many ways to approach this tattoo. One can say it is a post-modern interpretation of physicality. It could speak about thoughts in relation to flesh. Or perhaps it's just there for mere decoration.
In any sense, this is one of the few tattoos that have truly made me think. Tattoos are not just the domain for bikers and brutes. They are for the thinking man as well.
Quixoticals Is No Longer Being Updated
Quixoticals is no longer being updated. If you like quixoticals, check out my new blog Staretube -- a gallery of unusual videos.
You are here: Home > tattoo > A Tattoo for the Educated Man
Friday, March 23, 2007
A Tattoo for the Educated Man
Posted by
Christopher Trottier
at
2:31 AM
Labels:
education,
metaphysics,
philosophy,
tattoo
Social bookmark this post • View blog reactions
Translate: Portugues | Francais | Espanol | Deutsche | Italiano | Chinese | Korean | Japanese
Subscribe to:
Post Comments (Atom)





30 comments:
What is the text inside? I can't see it very well. Is it from a recognizable source?
..that's because you should click the picture to get a larger version ;)
It seems to be a collection of, say, tags: of stuff he likes or feels they define him - not all readable, and that adds to the coolness, I guess :)
Huffer
We at least it is personal - I always thought getting other peoples words on you was a bit odd - but each to his own.
That tattoo says one thing to me: I'm a weenie.
For the "educated man"? Why? Because it contains the words hyperarticulate and bacon? Sorry, reeks of smugness and a little self-importance to me, not smarts.
I think it would be cool to have some DNA code
AGTAAGCTAAGGCAATCCGATTATTACC ... etc
"One can say it is a post-modern interpretation of physicality. It could speak about thoughts in relation to flesh. Or perhaps it's just there for mere decoration."
This blog post made me puke on my shoes.
Couldn't agree more, gregory.
My impression is that underneath his paperthin skin is a bunch of meaningless bullshit. Sad, not cool.
wow.. cant believe all the self-indulgent tattoo experts here... sad, weeny, stupid tatoo? and puking while reading the blog? what a pathetic batch of goons you people are. The tattoo looks cool and helluva lot differnet than the crap other poeple call a "tattoo"... 'waste of ink' is what I call most of what is out there.... too bad you're all offended with your thin skin and
You forgot one word: depilation.
i was hoping it would be DNA code as well frank. now that would be cool.
nice man tits
Frank, I just thought you might like to know that the sequence of DNA that you typed in was from a Zebrafish.
http://www.ncbi.nlm.nih.gov/BLAST/Blast.cgi
I would have gone with 1s and 0s myself
So much hate, what's up with that.
This particular tat is not my thing. It's too big imo, but I do appreciate the art and the thought that was put into it.
"Tattoos are not just the domain for bikers and brutes. They are for the thinking man as well"
hmmmm don't go to a tattoo convention saying twatish things like this will you.
So much hate, what's up with that.
This particular tat is not my thing. It's too big imo, but I do appreciate the art and the thought that was put into it.
What's up with that? Well I think it might have something to do with that shitsucking expression on his face. Would have helped a bit if that had been excluded, IMHO.
Mama always said, "You can suck in your gut, but you ain't never could fer suckin' in yer titties, boy."
Damn you, mama. Damn you and how right you were. :(
Tattoos are personal and shouldn't be up for debate amongst anyone. At least that's how I feel about mine. If you're tats don't mean anything to you than perhaps you are a waste of flesh. Anyway, looks like some nice work; who did it?
Wow. Never have I seen a better use of someone's "general interest" list from myspace.
You ppl r all just mean and meanies ur the weenies lol
I'm surprised by all the negativity. I was thinking it's one of the coolest tattoos I've seen.
In any sense, this is one of the few tattoos that have truly made me think. Tattoos are not just the domain for bikers and brutes. They are for the thinking man as well.
So.. you just haven't seen very many tattoos, is my understanding. Or perhaps you prefer to think in stereotypes.
Yes, it really DOES make you think If you've NEVER THOUGHT BEFORE.
more like "A Tattoo for a lazy pretentious snobbish A-hole"
not much thinking involved as far as I can see..
very dumb tattoo and even dumber musings on it. there is nothing educated about this titty man's ugly carved up arm.
not too sure about the words used but thats why its not my tattoo. Awesome artwork and workmanship. I think it looks awesome!
The whole ideea of a tatto is to MARK something in ones life. it doesn't have to be pretty , smart or else.
it just has to have a MEANING for that person.That's the end of story.
...banana
well, i like it. a whole lot actually... it's different. it isn't some stupid chinese character for 'original' that nearly every other 16 year old chick has tattooed on her crack. and it certainly isn't some stupid "remember to breathe or you'll die as an aerobic creature" on your inner wrist.
i like it. it's original & really, it makes no difference whether i like it nor not either. its yours and yours alone.
good work.
Post a Comment